Researching

Journals
  • Advanced Photonics
  • Photonics Insights
  • Advanced Photonics Nexus
  • Photonics Research
  • Advanced Imaging
  • View All Journals
  • Chinese Optics Letters
  • High Power Laser Science and Engineering
    • Articles
  • Optics
  • Physics
  • Geography
  • View All Subjects
    • Conferences
  • CIOP
  • HPLSE
  • AP
  • View All Events
    • News
    About CLP
    Search by keywords or author
    Journals >Journal of Inorganic Materials >Volume 36 >Issue 12 >Page 1316 > Article
    • Journal of Inorganic Materials
    • Vol. 36, Issue 12, 1316 (2021)
    Titanium Modified with ZnO Nanofilm and Fibronectin: Preventing Peri-implantitis and Biocompatibility
    Dawei ZHANG1, Liyuan ZHU2, Hongliang LU2, and Zuolin WANG1、*
    Author Affiliations
  • 11. Shanghai Engineering Research Center of Tooth Restoration and Regeneration, Department of Implantology, School & Hospital of Stomatology, Tongji University, Shanghai 200072, China
  • 22. State Key Laboratory of ASIC and System, Shanghai Institute of Intelligent Electronics & Systems, School of Microelectronics, Fudan University, Shanghai 200433, China
    • show less
    DOI: 10.15541/jim20210125 Cite this Article
    Dawei ZHANG, Liyuan ZHU, Hongliang LU, Zuolin WANG. Titanium Modified with ZnO Nanofilm and Fibronectin: Preventing Peri-implantitis and Biocompatibility[J]. Journal of Inorganic Materials, 2021, 36(12): 1316 Copy Citation Text show less
    (a) Schematic diagram of fabrication progress of Ti/ZnO and Ti/ZnO/Fn, and SEM images of (b, e) Ti, (c, f) Ti/ZnO and (d, g) Ti/ZnO/Fn at low (b-d) and high (e-g) magnification
    1. (a) Schematic diagram of fabrication progress of Ti/ZnO and Ti/ZnO/Fn, and SEM images of (b, e) Ti, (c, f) Ti/ZnO and (d, g) Ti/ZnO/Fn at low (b-d) and high (e-g) magnification
    Download full size | View in the Article
    (a) XPS spectra of Ti, Ti/ZnO, and Ti/ZnO/Fn, (b) high-resolution spectra of N1s peak of Ti, Ti/ZnO, Ti/ZnO/APTES, and Ti/ZnO/Fn, and (c) FT-IR spectra of Ti/ZnO/APTES and Ti/ZnO/Fn Ti/ZnO/APTES: Ti disc with ZnO nanofilm modified with APTES
    2. (a) XPS spectra of Ti, Ti/ZnO, and Ti/ZnO/Fn, (b) high-resolution spectra of N1s peak of Ti, Ti/ZnO, Ti/ZnO/APTES, and Ti/ZnO/Fn, and (c) FT-IR spectra of Ti/ZnO/APTES and Ti/ZnO/Fn Ti/ZnO/APTES: Ti disc with ZnO nanofilm modified with APTES
    Download full size | View in the Article
    Antibacterial effects and mechanisms of Ti, Ti/ZnO, and Ti/ZnO/Fn against A. a and P. g for 24 h
    3. Antibacterial effects and mechanisms of Ti, Ti/ZnO, and Ti/ZnO/Fn against A. a and P. g for 24 h
    Download full size | View in the Article
    Cytocompatibility of Ti/ZnO/Fn on human gingival fibroblasts
    4. Cytocompatibility of Ti/ZnO/Fn on human gingival fibroblasts
    Download full size | View in the Article
    Quantification of the gene expression of (a) Col1, (b) Col3 and (c) ITGB1a in hGFs on Ti, Ti/ZnO and Ti/ZnO/Fn for 3 d by qPCR
    5. Quantification of the gene expression of (a) Col1, (b) Col3 and (c) ITGB1a in hGFs on Ti, Ti/ZnO and Ti/ZnO/Fn for 3 d by qPCR
    Download full size | View in the Article
    (a) Sagittal pictures of Micro-CT, (b) H&E-stained tissues around screws, and (c) quantification of the gene expression of IL1β, Arg1, TNFα, IL4, and TGFβ1 by qPCR in gingiva tissues around Ti, Ti/ZnO and Ti/ZnO/Fn screws after being inserted into maxillae of rats for 4 w
    6. (a) Sagittal pictures of Micro-CT, (b) H&E-stained tissues around screws, and (c) quantification of the gene expression of IL1β, Arg1, TNFα, IL4, and TGFβ1 by qPCR in gingiva tissues around Ti, Ti/ZnO and Ti/ZnO/Fn screws after being inserted into maxillae of rats for 4 w
    Download full size | View in the Article
    Reactive oxygen species (ROS) detected by fluorescence probes in bacteria cultured on materials for 24 h
    S1. Reactive oxygen species (ROS) detected by fluorescence probes in bacteria cultured on materials for 24 h
    Download full size | View in the Article
    GeneForward primer sequence (5′-3′)Reverse primer sequence (3′-5′)
    GAPDHGCACCGTCAAGGCTGAGAACTGGTGAAGACGCCAGTGGA
    Col1TCTAGACATGTTCAGCTTTGTGGACTCTGTACGCAGGTGATTGGTG
    Col3GCAAATTCACCTACACAGTTCTGGACTTGATCAGGACCACCAATGTCATA
    ITGB1αTGTGTCAGACCTGCCTTGGTGAGGAACATTCCTGTGTGCATGTG
    Table 1. Specific forward and reverse primer sequences of detected genes of HGFs
    View in the Article
    GeneForward primer sequence (5′-3′)Reverse primer sequence (3′-5′)
    GAPDHCCCCAATGTATCCGTTGTGCTCAGTGTAGCCCAGGATGC
    IL1βGACCTGTTCTTTGAGGCTGACACTCATCTGGACAGCCCAAGTC
    Arg1AGCAGAGACCCAGAAGAATGTTTCCTTTCAGTTCCTTCAG
    TNFαGACAAGGCTGCCCCGACTATGGGAGACTCCTCCCAGGTACA
    IL4TCGCTTGCCTTGGTGGTCTGTGATGTTGCTCAGCTCCTC
    TGFβ1AGGACCTGGGTTGGAAGTGGAGTTGGCATGGTAGCCCTTG
    Table 2. Specific forward and reverse primer sequences of detected genes of rat
    View in the Article
    SampleC1s/%O1s/%N1s/%Si2p3/%Ti2p3/%Zn2p3/%
    Ti57.6931.071.920.029.260.05
    Ti/ZnO38.9437.222.260.081.0720.44
    Ti/ZnO/Fn63.9121.211.882.270.130.6
    Table 3. Elemental chemical composition of Ti, Ti/ZnO and Ti/ZnO/Fn
    View in the Article
    Abstract
    Get PDF(in Chinese)
    Figures&Tables (10)
    Equations (2)
    References (24)
    Get Citation
    Copy Citation Text
    Dawei ZHANG, Liyuan ZHU, Hongliang LU, Zuolin WANG. Titanium Modified with ZnO Nanofilm and Fibronectin: Preventing Peri-implantitis and Biocompatibility[J]. Journal of Inorganic Materials, 2021, 36(12): 1316
    Download Citation
    Tools
    Share
    Save the article for my favorites
    Paper Information
    Recommended Topics
    laser devices and laser physics
    Lasers and Laser Optics
    Laser physics
    laser manufacturing
    Instrumentation, Measurement and Metrology