• Chinese Journal of Lasers
  • Vol. 45, Issue 3, 307002 (2018)
Huang Shiguang1、2、3、*, Jin Xiangyu1, Lin Rongzan1, Lin Xue1, Xue Ning1, Fan Yunqian1, Zu Guo1, Ma Li4, Luo Xianbo4, and Huang Guoliang1、4
Author Affiliations
  • 1[in Chinese]
  • 2[in Chinese]
  • 3[in Chinese]
  • 4[in Chinese]
  • show less
    DOI: 10.3788/CJL201845.0307002 Cite this Article Set citation alerts
    Huang Shiguang, Jin Xiangyu, Lin Rongzan, Lin Xue, Xue Ning, Fan Yunqian, Zu Guo, Ma Li, Luo Xianbo, Huang Guoliang. Microfluidic Chip Based Nucleic Acid Analyzer and Its Application in Precision Medicine[J]. Chinese Journal of Lasers, 2018, 45(3): 307002 Copy Citation Text show less
    Principle diagram of isothermal nucleic acid amplification. (a) Initialization phase; (b) circulatory phase
    Fig. 1. Principle diagram of isothermal nucleic acid amplification. (a) Initialization phase; (b) circulatory phase
    Structural diagram of microfluidic chip with 24 channels
    Fig. 2. Structural diagram of microfluidic chip with 24 channels
    Schematic diagram of nucleic acid analyzer
    Fig. 3. Schematic diagram of nucleic acid analyzer
    (a)(b) Photos of micro-fluidic chip based nucleic acid analyzer; (c) photo of micro-fluidic chip kit
    Fig. 4. (a)(b) Photos of micro-fluidic chip based nucleic acid analyzer; (c) photo of micro-fluidic chip kit
    Results of microfluidic chip based isothermal nucleic acid amplification. (a) Result of sensitivity test; (b) result of linearity test; (c) result of specificity test
    Fig. 5. Results of microfluidic chip based isothermal nucleic acid amplification. (a) Result of sensitivity test; (b) result of linearity test; (c) result of specificity test
    Testing indexProbe codeBase sequence of probe
    MycoplasmapneumoniaF3CTCACCGTAGTGGGACA
    B3GCCCCGGGATTTTCACC
    FIPCGTCAGGGCGGGTGTAGCTCTTCACAAGTACCACCACGAC
    BIPTGCGCCACACCAATGCCATGGGAGGGAGGAAAAGCT
    LFATTGCTGGCGCTTGAGC
    LBCGCGCTTAACCCCGTGA
    Table 1. Example for gene-specific probes of pathogenic bacteria
    Test indexResult fromdevelopedanalyzerResult from ABI 7500Positivecoincidencerate /%Negativecoincidencerate /%Totalcoincidencerate /%
    PositiveNo.NegativeNo.SubtotalNo.
    Positive No.23124
    SauNegative No.0767610098.799.0
    Subtotal No.2377100
    Positive No.22123
    MRSANegative No.0777710098.799.0
    Subtotal No.2278100
    Positive No.14115
    MpnNegative No.1848593.398.898.0
    Subtotal No.1585100
    Positive No.59362
    TotalNegative No.123723898.398.898.7
    Subtotal No.60240300
    Table 2. Results of clinical sample test
    Sample No.ABI 7500DevelopedanalyzerReanalysisby ABI 7500Reanalysis bydeveloped analyzerSequencing
    22MpnSauMpnSauSau
    32SauSau, MRSASauSau, MRSASau, MRSA
    Table 3. Analysis of discrepancy samples of test result
    Huang Shiguang, Jin Xiangyu, Lin Rongzan, Lin Xue, Xue Ning, Fan Yunqian, Zu Guo, Ma Li, Luo Xianbo, Huang Guoliang. Microfluidic Chip Based Nucleic Acid Analyzer and Its Application in Precision Medicine[J]. Chinese Journal of Lasers, 2018, 45(3): 307002
    Download Citation