• Journal of Radiation Research and Radiation Processing
  • Vol. 42, Issue 4, 040301 (2024)
Tianyi ZHANG1,2, Pengfei YANG1,2,3, Jufang WANG1,2,*, and Heng ZHOU1,2,4,**
Author Affiliations
  • 1Key Laboratory of Space Radiobiology of Gansu Province, Institute of Modern Physics, Chinese Academy of Sciences, Lanzhou 730000, China
  • 2University of Chinese Academy of Sciences, Beijing 100049, China
  • 3Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou 730000, China
  • 4Yangzhou University, Yangzhou 225009, China
  • show less
    DOI: 10.11889/j.1000-3436.2024-0013 Cite this Article
    Tianyi ZHANG, Pengfei YANG, Jufang WANG, Heng ZHOU. Carbon ions inhibit non-small cell lung cancer cell proliferation by inducing mitochondrial damage[J]. Journal of Radiation Research and Radiation Processing, 2024, 42(4): 040301 Copy Citation Text show less
    Inhibition of cell proliferation by carbon ion irradiation: (a) A549 clone formation; (b) cell proliferation rate
    Fig. 1. Inhibition of cell proliferation by carbon ion irradiation: (a) A549 clone formation; (b) cell proliferation rate
    Morphological changes of mitochondria after different dose of carbon ion radiation: (a, b) Mito-tracker Green/Red staining of mitochondria in A549; (c) mitochondrial length of single cell; (d) dye enrichment in single cell (color online)
    Fig. 2. Morphological changes of mitochondria after different dose of carbon ion radiation: (a, b) Mito-tracker Green/Red staining of mitochondria in A549; (c) mitochondrial length of single cell; (d) dye enrichment in single cell (color online)
    Level of mitochondrial dependent apoptosis increased with carbon ion radiation: (a~f) Western blot of Bax / Bak, and their relative expression of protein and mRNA; (g~j) Western blot of Cyto-C / SMAC protein, and their relative expression of protein; (k~n) Immunofluorescence staining of Cyto-C and SMAC, and their average fluorescence intensity; (o) Annexin-V/PI staining, flow cytometry to detect apoptosis; (p) Apoptotic rate of A549 cells at different doses
    Fig. 3. Level of mitochondrial dependent apoptosis increased with carbon ion radiation: (a~f) Western blot of Bax / Bak, and their relative expression of protein and mRNA; (g~j) Western blot of Cyto-C / SMAC protein, and their relative expression of protein; (k~n) Immunofluorescence staining of Cyto-C and SMAC, and their average fluorescence intensity; (o) Annexin-V/PI staining, flow cytometry to detect apoptosis; (p) Apoptotic rate of A549 cells at different doses
    Level of mitophagy increased after carbon ion irradiation: (a) immunofluorescence co-localization of lysosome and mitochondria at different irradiation doses; (b) relative intensity of immunofluorescence co-localization of lysosome and mitochondria; (c) western blot of autophagy markers LC3B, Beclin1 and p62; (d) relative expression of LC3B II/LC3B I protein; (e~f) relative expression of Beclin1 and p62 protein; (g~i) western blot of mitophagy markers Parkin and BNIP3 and their relative expression of protein (color online)
    Fig. 4. Level of mitophagy increased after carbon ion irradiation: (a) immunofluorescence co-localization of lysosome and mitochondria at different irradiation doses; (b) relative intensity of immunofluorescence co-localization of lysosome and mitochondria; (c) western blot of autophagy markers LC3B, Beclin1 and p62; (d) relative expression of LC3B II/LC3B I protein; (e~f) relative expression of Beclin1 and p62 protein; (g~i) western blot of mitophagy markers Parkin and BNIP3 and their relative expression of protein (color online)
    Mitochondria-free cells compared with control group: (a) western blot of Tomm20 protein in A549 cells treated with high level of CCCP and control group; (b) relative expression of Tomm20 protein; (c) Annexin-V/PI staining, flow cytometry to detect apoptosis
    Fig. 5. Mitochondria-free cells compared with control group: (a) western blot of Tomm20 protein in A549 cells treated with high level of CCCP and control group; (b) relative expression of Tomm20 protein; (c) Annexin-V/PI staining, flow cytometry to detect apoptosis
    Gene Primer Sequence 5′-3′

    Bax Forward GACGAACTGGACAGTAACATGGA

    Reverse GCAAAGTAGAAAAGGGCGACA

    Bak Forward ATGGTCACCTTACCTCTGCAACCTA

    Reverse CTGCAACATGGTCTGGAACTCT

    GAPDH Forward GCACCGTCAAGGCTGAGAAC

    Reverse TGGTGAAGACGCCAGTGGA

    Table 1. [in Chinese]
    Tianyi ZHANG, Pengfei YANG, Jufang WANG, Heng ZHOU. Carbon ions inhibit non-small cell lung cancer cell proliferation by inducing mitochondrial damage[J]. Journal of Radiation Research and Radiation Processing, 2024, 42(4): 040301
    Download Citation