• Journal of Inorganic Materials
  • Vol. 38, Issue 7, 830 (2023)
Wei WU1、2, Shahd BAKHET2, Naomi Addai ASANTE2, Shefiu KAREEM2, Omar Ramadhan KOMBO3, Binbin LI2, and Honglian DAI1、2、*
Author Affiliations
  • 11. Shenzhen Institute of Wuhan University of Technology, Shenzhen 518000, China
  • 22. State Key Laboratory of Advanced Technology for Materials Synthesis and Processing, Biomedical Materials and Engineering Research Center of Hubei Province, Wuhan University of Technology, Wuhan 430070, China
  • 33. Department of Medical Science and Technology, Mbeya University of Science and Technology, Mbeya, Tanzania
  • show less
    DOI: 10.15541/jim20220662 Cite this Article
    Wei WU, Shahd BAKHET, Naomi Addai ASANTE, Shefiu KAREEM, Omar Ramadhan KOMBO, Binbin LI, Honglian DAI. In vitro Study of Biphasic Calcium Magnesium Phosphate Microspheres for Angiogenesis and Bone Formation [J]. Journal of Inorganic Materials, 2023, 38(7): 830 Copy Citation Text show less
    XRD patterns of prepared TCP/TMP composite materials
    1. XRD patterns of prepared TCP/TMP composite materials
    SEM images of different microsphere composites with insets showing their corresponding particle size distributions(a)TCP; (b) 25% TMP; (c) 50% TMP; (d) 75% TMP; (e) TMP
    2. SEM images of different microsphere composites with insets showing their corresponding particle size distributions(a)TCP; (b) 25% TMP; (c) 50% TMP; (d) 75% TMP; (e) TMP
    TG/DTA/DTG curves of microspheres prepared by water in oil emulsion cross-linking method(a) TCP; (b) 25%TMP; (c) 50%TMP; (d) 75%TMP; (e) TMP
    3. TG/DTA/DTG curves of microspheres prepared by water in oil emulsion cross-linking method(a) TCP; (b) 25%TMP; (c) 50%TMP; (d) 75%TMP; (e) TMP
    Released Ca2+and Mg2+ concentrations from materials immersed in tris-HCl solution
    4. Released Ca2+and Mg2+ concentrations from materials immersed in tris-HCl solution
    Cell viabilities of (a) MC3T3-E1 and (b) HUVECs assessed by CCK-8 assay(a) MC3T3-E1 and (b) HUVECs assayed on day 1, 3, 5 cultured with different microspheres concentration extracts *: p p p < 0.0002; Colorful figures are available on website
    5. Cell viabilities of (a) MC3T3-E1 and (b) HUVECs assessed by CCK-8 assay(a) MC3T3-E1 and (b) HUVECs assayed on day 1, 3, 5 cultured with different microspheres concentration extracts *: p < 0.01; **: p < 0.005; ***: p < 0.0002; Colorful figures are available on website
    ALP activity and ARS staining of MC3T3-E1 cells cultured with microspheres extract compared with the control on the 7th and 14th day
    6. ALP activity and ARS staining of MC3T3-E1 cells cultured with microspheres extract compared with the control on the 7th and 14th day
    (a) VEGF and (b) FGF of HUVECs cultured with microspheres extracts on the 1st and 3rd day
    7. (a) VEGF and (b) FGF of HUVECs cultured with microspheres extracts on the 1st and 3rd day
    (a) COLI and (b) OPN genes expression of MC3T3-E1 which cultured with microspheres extract compared to the control on the 3rd and 7th day
    8. (a) COLI and (b) OPN genes expression of MC3T3-E1 which cultured with microspheres extract compared to the control on the 3rd and 7th day
    SEM images of different microsphere composites with Bars at 200 μm (up row) and 10 μm (down row)
    S1. SEM images of different microsphere composites with Bars at 200 μm (up row) and 10 μm (down row)
    XRD patterns of TMP (a) and β-TCP (b)
    S2. XRD patterns of TMP (a) and β-TCP (b)
    GenePrimer sequence
    VEGFAGGAGTACCCCGACGAGATAGACACATCTGCTGTGCTGTAGGAA
    FGFACAGGAGCGACCAGCACATTTTGGTGTCTGCGAGCCGTAT
    COL ICACTGCAAGAACAGCGTAGCAAGTTCCGGTGTGACTCGTG
    OPNACACTTTCACTCCAATCGTCCCTACGGACTCCTTAGACTCACCGCTCTT
    Table 1.

    Primer sequences used in RT-qPCR

    Wei WU, Shahd BAKHET, Naomi Addai ASANTE, Shefiu KAREEM, Omar Ramadhan KOMBO, Binbin LI, Honglian DAI. In vitro Study of Biphasic Calcium Magnesium Phosphate Microspheres for Angiogenesis and Bone Formation [J]. Journal of Inorganic Materials, 2023, 38(7): 830
    Download Citation